Strain Information | |
---|---|
Image | |
BRC No. | RBRC10342 |
Type | CRISPR/Cas9 (Transgene)![]() |
Species | Mus musculus |
Strain name | B6D2-Fam170b<em2Osb> |
Former Common name | Fam170b-35/wt |
H-2 Haplotype | |
ES Cell line | |
Background strain | |
Appearance | |
Strain development | Developed by Kaori Nozawa and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2017. Fertilized eggs derived from BDF1 × BDF1 were used to generate this line. Mixed genetic background. |
Strain description | Fam170b<em2Osb>; 35 bp deletion at Exon 2TTTCTCAGGGAAGTTACGCATGGAGCCTTTCTGAGCACACTGATGAAACTGTCCTTCCACTTCTCAGGGGCCATGAGGAGGAATGAGTCATCTCCGCGGCCAGGGCCTGCCTTCCTCCCTGACGATGACATCTACTTGGCAGCCCGGGCACAGGGGGTGCTGGGTTGGAGCAGCTCTCCATCATCCCAGTCGTCCTCCGAGTATCAGTCCTACTCT |
Colony maintenance | |
References | Knockout of family with sequence similarity 170 member A (Fam170a) causes male subfertility, while Fam170b is dispensable in micedagger. Devlin D J, Nozawa K, Ikawa M, Matzuk M M Biol. Reprod., 103(2):205-222 (2020). 32588889 |
Health Report | |
---|---|
Examination Date / Room / Rack |
Gene | |||||||
---|---|---|---|---|---|---|---|
Gene Symbol | Gene Name | Chr. | Allele Symbol | Allele Name | Common Names | Promoter | Diseases Related to This Gene |
Fam170b MGI:2145650 | family with sequence similarity 170, member B | 14 | Fam170b<em2Osb> | endonuclease-mediated mutation 2, Research Institute for Microbial Diseases, Osaka University |
Phenotype | |
---|---|
Annotation by Mammalian phenotyhpe ontology | |
Detailed phenotype data |
Ordering Information | |
---|---|
Donor DNA | Streptococcus pyogenes crRNA, tracrRNA, Mouse a part of Fam170b gene |
Research application | |
Specific Term and Conditions | The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Biol. Reprod., 103(2):205-222 (2020). doi: 10.1093/biolre/ioaa082.The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
Depositor | Masahito Ikawa (Osaka University) |
Strain Status | ![]() |
Strain Availability | ![]() |
Additional Info. | Necessary documents for ordering:
|
BRC mice in Publications |
---|
No Data |