Strain Data Sheet

RBRC10342

Strain Information

Image
BRC No.RBRC10342
TypeCRISPR/Cas9 (Transgene)Cartagena
SpeciesMus musculus
Strain nameB6D2-Fam170b<em2Osb>
Former Common nameFam170b-35/wt
H-2 Haplotype
ES Cell line
Background strain
Appearance
Strain developmentDeveloped by Kaori Nozawa and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2017. Fertilized eggs derived from BDF1 × BDF1 were used to generate this line. Mixed genetic background.
Strain descriptionFam170b<em2Osb>; 35 bp deletion at Exon 2TTTCTCAGGGAAGTTACGCATGGAGCCTTTCTGAGCACACTGATGAAACTGTCCTTCCACTTCTCAGGGGCCATGAGGAGGAATGAGTCATCTCCGCGGCCAGGGCCTGCCTTCCTCCCTGACGATGACATCTACTTGGCAGCCCGGGCACAGGGGGTGCTGGGTTGGAGCAGCTCTCCATCATCCCAGTCGTCCTCCGAGTATCAGTCCTACTCT
Colony maintenance
References
Knockout of family with sequence similarity 170 member A (Fam170a) causes male subfertility, while Fam170b is dispensable in micedagger.
Devlin D J, Nozawa K, Ikawa M, Matzuk M M
Biol. Reprod., 103(2):205-222 (2020). 32588889

Health Report

Examination Date / Room / Rack

Gene

Gene SymbolGene NameChr.Allele SymbolAllele NameCommon NamesPromoterDiseases Related to This Gene
Fam170b
MGI:2145650
family with sequence similarity 170, member B14Fam170b<em2Osb> endonuclease-mediated mutation 2, Research Institute for Microbial Diseases, Osaka University

Phenotype

Annotation by Mammalian phenotyhpe ontology
Detailed phenotype data

Ordering Information

Donor DNAStreptococcus pyogenes crRNA, tracrRNA, Mouse a part of Fam170b gene
Research application
Specific Term and ConditionsThe RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Biol. Reprod., 103(2):205-222 (2020). doi: 10.1093/biolre/ioaa082.The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
DepositorMasahito Ikawa (Osaka University)
Strain Statusan icon for Frozen spermFrozen sperm
Strain AvailabilityRecovery and QC required prior to distribution
Additional Info.Necessary documents for ordering:
  1. Approval form (Japanese / English)
  2. Order form (Japanese / English)
  3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
  4. Acceptance of responsibility for living modified organism (Japanese / English)
Lab HP, Co-creation Bureau, Osaka University HP

BRC mice in Publications

No Data