Strain Information | |
---|---|
Image | |
BRC No. | RBRC10339 |
Type | CRISPR/Cas9 (Transgene)![]() |
Species | Mus musculus |
Strain name | STOCK Fbxl13<em1Osb> |
Former Common name | Fbxl13-30983/wt |
H-2 Haplotype | |
ES Cell line | EGR-G01 [129S2 x C57BL/6NCr-Tg(CAG/Acr-EGFP)] |
Background strain | |
Appearance | |
Strain development | Developed by Keisuke Shimada and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2017. EGR-G01 ES cells derived from (129S2 x B6Cr)F1 were used. Mice were crossed to BDF1. Mixed genetic background. |
Strain description | STOCK Fbxl13<em1Osb>; Deletin of Exon 2 to 8 of the Fbxl13CTCCCGTCCAGCCCTCTCATTTTACCCGGCCCCGGCCTGTACTGTCCTGCCCCGCCCCTCCCCGCTCTGCCCCGCCTCTCTGCACTCGCCCCGCCCCTCTCTGCCCCGCCCCTCTGCAATCGCCCCGCCCCGCCCCAGTTGC (deletion of Exon 2 to 8) TGTTGAGAACAGGCGCATAGCATTTGACATTTCAGTGCTACCGGAGCAAGCAATACTCCAGGTTTGTAGGAGTTTGTTGAATAGTTTTCTTACAATTTGAGTATAGTTTGGAGTTAGGGTAAGTATGTTTGCTTATAATTCCTTATTTTAAAAATTATCGGCTGGGCCGAAGTCTGGCTGATGAAGGGCGGAAGTAAGAGTACCAACTCCGCAATCATGGCTCAA |
Colony maintenance | |
References | Nexin-Dynein regulatory complex component DRC7 but not FBXL13 is required for sperm flagellum formation and male fertility in mice. Morohoshi A, Miyata H, Shimada K, Nozawa K, Matsumura T, Yanase R, Shiba K, Inaba K, Ikawa M PLoS Genet., 16(1):e1008585 (2020). 31961863 |
Health Report | |
---|---|
Examination Date / Room / Rack |
Gene | |||||||
---|---|---|---|---|---|---|---|
Gene Symbol | Gene Name | Chr. | Allele Symbol | Allele Name | Common Names | Promoter | Diseases Related to This Gene |
Fbxl13 MGI:2443416 | F-box and leucine-rich repeat protein 13 | 5 | Fbxl13<em1Osb> | endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
Phenotype | |
---|---|
Annotation by Mammalian phenotyhpe ontology | |
Detailed phenotype data |
Ordering Information | |
---|---|
Donor DNA | human hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized), crRNA, tracrRNA, Escherichia coli ampicillin resistance gene, Streptomyces alboniger puromycin resistant gene, Mouse a part of Fbxl13 gene |
Research application | |
Specific Term and Conditions | The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. PLoS Genet., 16(1):e1008585 (2020).The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
Depositor | Masahito Ikawa (Osaka University) |
Strain Status | ![]() |
Strain Availability | ![]() |
Additional Info. | Necessary documents for ordering:
|
BRC mice in Publications |
---|
No Data |