Strain Data Sheet

RBRC10328

Strain Information

Image
BRC No.RBRC10328
TypeCRISPR/Cas9 (Transgene)Cartagena
SpeciesMus musculus
Strain nameSTOCK Spaca1<em1(Spaca1/PA)Osb>/4E
Former Common nameSpaca1v1-PA#4E
H-2 Haplotype
ES Cell lineEGR-G01 [129S2 x C57BL/6NCr-Tg(CAG/Acr-EGFP)]
Background strain
Appearance
Strain developmentDeveloped by Yoshitaka Fujihara and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2017. EGR-G01 ES cells derived from (129S2 x B6Cr)F1 were used. Mice were crossed to BDF1. Mixed genetic background.
Strain descriptionThis strain has a C-terminal PA tag at the Spaca1 variant 1 which was generated by the genome editing technique. Spaca1<em1(Spaca1/PA)Osb>/4E; PA tag insertion after exon 10 for Spaca1 variant 1. Tgcgaacaagacaaggatattgagagttgctcagaa(GGCGTTGCCATGCCAGGTGCCGAAGATGATGTGGTGtagAATTC)tggttgatggagatgcctctaggtcagcattcagtgat
Colony maintenance
References
SPACA1-deficient male mice are infertile with abnormally shaped sperm heads reminiscent of globozoospermia.
Fujihara Y, Satouh Y, Inoue N, Isotani A, Ikawa M, Okabe M
Development, 139(19):3583-9 (2012). 22949614

Health Report

Examination Date / Room / Rack

Gene

Gene SymbolGene NameChr.Allele SymbolAllele NameCommon NamesPromoterDiseases Related to This Gene

Phenotype

Annotation by Mammalian phenotyhpe ontology
Detailed phenotype data

Ordering Information

Donor DNAHuman hU6 promoter, CMV enhancer (CBh), Chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized), crRNA, tracrRNA, Escherichia coli ampicillin resistant gene, Streptomyces alboniger puromycin resistant gene, Escherichia coli Lac Z, T7 phage T7 promoter, Escherichia coli lac promoter, Mouse a part of Spaca1 gene, Human PA tag
Research application
Specific Term and ConditionsThe RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Development, 139(19):3583-9 (2012).The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
DepositorMasahito Ikawa (Osaka University)
Strain Statusan icon for Frozen spermFrozen sperm
Strain AvailabilityRecovery and QC required prior to distribution
Additional Info.Necessary documents for ordering:
  1. Approval form (Japanese / English)
  2. Order form (Japanese / English)
  3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
  4. Acceptance of responsibility for living modified organism (Japanese / English)
Lab HP, Co-creation Bureau, Osaka University HP

BRC mice in Publications

No Data