Strain Information | |
---|---|
Image | |
BRC No. | RBRC10328 |
Type | CRISPR/Cas9 (Transgene) |
Species | Mus musculus |
Strain name | STOCK Spaca1<em1(Spaca1/PA)Osb>/4E |
Former Common name | Spaca1v1-PA#4E |
H-2 Haplotype | |
ES Cell line | EGR-G01 [129S2 x C57BL/6NCr-Tg(CAG/Acr-EGFP)] |
Background strain | |
Appearance | |
Strain development | Developed by Yoshitaka Fujihara and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2017. EGR-G01 ES cells derived from (129S2 x B6Cr)F1 were used. Mice were crossed to BDF1. Mixed genetic background. |
Strain description | This strain has a C-terminal PA tag at the Spaca1 variant 1 which was generated by the genome editing technique. Spaca1<em1(Spaca1/PA)Osb>/4E; PA tag insertion after exon 10 for Spaca1 variant 1. Tgcgaacaagacaaggatattgagagttgctcagaa(GGCGTTGCCATGCCAGGTGCCGAAGATGATGTGGTGtagAATTC)tggttgatggagatgcctctaggtcagcattcagtgat |
Colony maintenance | |
References | SPACA1-deficient male mice are infertile with abnormally shaped sperm heads reminiscent of globozoospermia. Fujihara Y, Satouh Y, Inoue N, Isotani A, Ikawa M, Okabe M Development, 139(19):3583-9 (2012). 22949614 |
Health Report | |
---|---|
Examination Date / Room / Rack |
Gene | |||||||
---|---|---|---|---|---|---|---|
Gene Symbol | Gene Name | Chr. | Allele Symbol | Allele Name | Common Names | Promoter | Diseases Related to This Gene |
Phenotype | |
---|---|
Annotation by Mammalian phenotyhpe ontology | |
Detailed phenotype data |
Ordering Information | |
---|---|
Donor DNA | Human hU6 promoter, CMV enhancer (CBh), Chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized), crRNA, tracrRNA, Escherichia coli ampicillin resistant gene, Streptomyces alboniger puromycin resistant gene, Escherichia coli Lac Z, T7 phage T7 promoter, Escherichia coli lac promoter, Mouse a part of Spaca1 gene, Human PA tag |
Research application | |
Specific Term and Conditions | The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Development, 139(19):3583-9 (2012).The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
Depositor | Masahito Ikawa (Osaka University) |
Strain Status | Frozen sperm |
Strain Availability | Recovery and QC required prior to distribution |
Additional Info. | Necessary documents for ordering:
|
BRC mice in Publications |
---|
No Data |