Strain Information | |
---|---|
Image | |
BRC No. | RBRC10220 |
Type | CRISPR/Cas9 (Transgene) |
Species | Mus musculus |
Strain name | B6.B6CB-Rnf31<tm1.1Kiwa> Ripk3<em2Kiwa> |
Former Common name | Conditional HOIP delta linear/RIP3 kcockout mice |
H-2 Haplotype | |
ES Cell line | |
Background strain | |
Appearance | |
Strain development | Developed by Kazuhiro Iwai, Graduate School of Medicine and Faculty of Medicine Kyoto University. Rnf31 floxed mice(RBRC09483)was developed using the TT2 ES cell line [(C57BL/6 x CBA)F1]. A pair of loxP sites were flanking exons encoding a RING-IBR-RING domain. A FRT-flanked Neo resistance gene was deleted. C57BL/6 congenic strain. This strain was further modified with the CRISPR/Cas9, resulting in 5 bp deletion at Exon 3 of the Ripk3 gene. |
Strain description | Compound mutant mice harboring floxed Rnf31 and 5 bp deletion at Exon 3 of Ripk3. Ripk3<em2Kiwa>: 5 bp deletion at Exon 3. CCTCCGCTCCTGCACCGGGACCT |
Colony maintenance | |
References | EMBO J, 32, 2463-2476 (2013). 23942237 J. Immunol., 200(10) 3438-3449 (2018). 29654209 |
Health Report | |
---|---|
Examination Date / Room / Rack |
Gene | |
---|---|
Gene info | Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Ripk3receptor-interacting serine-threonine kinase 314Ripk3<em2Kiwa>endonuclease-mediated mutation 2, Kazuhiro Iwai Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Frtyeast FRT (flippase recombination target) site14Frt Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter loxPphage P1 loxP14loxP Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter loxPphage P1 loxP14loxP |
Ordering Information | |
---|---|
Donor DNA | Phage P1 loxP sites, yeast FRT (flipase recombination target) site, mouse Rnf31 genomic DNA |
Research application | Cre/loxP system FLP/frt system |
Specific Term and Conditions | Prior to requesting the BIOLOGICAL RESOURCE, the RECIPIENT must obtain approval from the DEPOSITOR using the Approval Form. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. (will be announced.) The RECIPIENT agrees to use this BIOLOGICAL RESOURCE as a collaboration with the DEPOSITOR. For use of the BIOLOGICAL RESOURCE by a for-profit institution, the RECIPIENT must reach agreement on terms and conditions of use of it with DEPOSITOR and must obtain a prior written consent from the DEPOSITOR. The RECIPIENT must contact the DEPOSITOR in the case of application for any patents or commercial use based on the results from the use of the BIOLOGICAL RESOURCE. |
Depositor | Kazuhiro Iwai (Kyoto University) |
Strain Status | Frozen embryos Frozen sperm |
Strain Availability | Recovered litters from cryopreserved embryos (2 to 4 months) Cryopreserved sperm (within 1 month) |
Additional Info. | Necessary documents for ordering:
Genotyping protocol -PCR- |
BRC mice in Publications |
---|
No Data |