Strain Data Sheet

RBRC10219

Strain Information

Image
BRC No.RBRC10219
TypeCRISPR/Cas9 (Transgene)Cartagena
SpeciesMus musculus
Strain nameB6.B6CB-Rnf31<tm1.1Kiwa> Ripk3<em1Kiwa>
Former Common nameConditional HOIP delta linear/RIP3 kcockout mice
H-2 Haplotype
ES Cell lineTT2 [(C57BL/6NCrlj x CBA/JNCrlj)F1]
Background strain
Appearance
Strain developmentDeveloped by Kazuhiro Iwai, Graduate School of Medicine and Faculty of Medicine Kyoto University. Rnf31 floxed mice(RBRC09483)was developed using the TT2 ES cell line [(C57BL/6 x CBA)F1]. A pair of loxP sites were flanking exons encoding a RING-IBR-RING domain. A FRT-flanked Neo resistance gene was deleted. C57BL/6 congenic strain. This strain was further modified with the CRISPR/Cas9, resulting in 7 bp deletion at Exon 3 of the Ripk3 gene.
Strain descriptionCompound mutant mice harboring floxed Rnf31 and 7 bp deletion at Exon 3 of Ripk3.Ripk3<em1Kiwa>: 7 bp deletion at Exon 3. ACCGAGTGCCCTCGGCCCTGG
Colony maintenance
References
Defective immune responses in mice lacking LUBAC-mediated linear ubiquitination in B cells.
Sasaki Y, Sano S, Nakahara M, Murata S, Kometani K, Aiba Y, Sakamoto S, Watanabe Y, Tanaka K, Kurosaki T, Iwai K
EMBO J, 32, 2463-2476 (2013). 23942237

Crucial Role of Linear Ubiquitin Chain Assembly Complex-Mediated Inhibition of Programmed Cell Death in TLR4-Mediated B Cell Responses and B1b Cell Development.
Sasaki Y, Iwai K
J. Immunol., 200(10) 3438-3449 (2018). 29654209

Health Report

Examination Date / Room / Rack

Gene

Gene SymbolGene NameChr.Allele SymbolAllele NameCommon NamesPromoterDiseases Related to This Gene
Frt yeast FRT (flippase recombination target) site14Frt
Ripk3
MGI:2154952		receptor-interacting serine-threonine kinase 314Ripk3<em1Kiwa> endonuclease-mediated mutation 1, Kazuhiro Iwai
Rnf31
MGI:1934704		ring finger protein 3114Rnf31<tm1.1Kiwa>
MGI:5550368		targeted mutation 1.1, Kazuhiro Iwai
loxP phage P1 loxP14loxP
loxP phage P1 loxP14loxP

Phenotype

Annotation by Mammalian phenotyhpe ontology
  • abnormal B-1 B cell morphology(MP:0004940)

  • abnormal humoral immune response(MP:0001800)

  • decreased B-1a cell number(MP:0008168)

  • decreased B-1b cell number(MP:0008170)

  • decreased IgA level(MP:0001807)
    • more 6 phenotypes
  • decreased IgG1 level(MP:0008495)

  • decreased IgG2a level(MP:0008496)

  • decreased IgG2b level(MP:0008497)

  • decreased IgG3 level(MP:0008498)

  • decreased IgM level(MP:0001806)

  • immune system phenotype(MP:0005387)
    • Detailed phenotype data

    Ordering Information

    Donor DNAPhage P1 loxP sites, yeast FRT (flipase recombination target) site, mouse Rnf31 genomic DNA
    Research applicationCre/loxP system
    FLP/frt system
    Specific Term and ConditionsPrior to requesting the BIOLOGICAL RESOURCE, the RECIPIENT must obtain approval from the DEPOSITOR using the Approval Form. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. (will be announced.) The RECIPIENT agrees to use this BIOLOGICAL RESOURCE as a collaboration with the DEPOSITOR. For use of the BIOLOGICAL RESOURCE by a for-profit institution, the RECIPIENT must reach agreement on terms and conditions of use of it with DEPOSITOR and must obtain a prior written consent from the DEPOSITOR. The RECIPIENT must contact the DEPOSITOR in the case of application for any patents or commercial use based on the results from the use of the BIOLOGICAL RESOURCE.
    DepositorKazuhiro Iwai (Kyoto University)
    Strain Statusan icon for Frozen spermFrozen sperm
    Strain AvailabilityRecovered litters from cryopreserved sperm (2 to 4 months)
    Cryopreserved sperm (within 1 month)
    Additional Info.Necessary documents for ordering:
    1. Approval form (Japanese / English)
    2. Order form (Japanese / English)
    3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
    4. Acceptance of responsibility for living modified organism (Japanese / English)

    BRC mice in Publications

    No Data