Strain Data Sheet

RBRC10184

Strain Information

Image
BRC No.RBRC10184
TypeCRISPR/Cas9Cartagena
SpeciesMus musculus
Strain nameB6D2-Izumo1<em1Nino>
Former Common nameIzumo1-KO, IZUMO1_v1 KO
H-2 Haplotype
ES Cell line
Background strain
Appearance
Strain developmentDeveloped by Takako Saito・Naokazu Inoue, Fukushima Medical University in 2017. B6D2 genetic background.
Strain descriptionIzumo1 mutant mice. 9 bp deletion including a translation initiation codon. Izumo1<em1Nino>: 9 bp deletion,ATCCTCTGGCGGTGCTGGCAAGCTGTGCGTTCTGGCCTTCATGGGGCCGCATTTTACACT
Colony maintenance
ReferencesSci. Rep., 9(1):3151 (2019). 30816314
Nature, 434, 234-238 (2005). 15759005

Health Report

Examination Date / Room / Rack

Gene

Gene info
Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Izumo1izumo sperm-egg fusion 17Izumo1<em1Nino>endonuclease-mediated mutation 1, Naokazu Inoue

Ordering Information

Donor DNA
Research application
Specific Term and ConditionsPrior to requesting the BIOLOGICAL RESOURCE, the RECIPIENT must obtain approval from the DEPOSITOR using the Approval Form.
DepositorNaokazu Inoue (Fukushima Medical University)
Strain Statusan icon for Frozen spermFrozen sperm
Strain AvailabilityRecovered litters from cryopreserved sperm (2 to 4 months)
Cryopreserved sperm (within 1 month)
Additional Info.Necessary documents for ordering:
  1. Approval form (Japanese / English)
  2. Order form (Japanese / English)
  3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
  4. Acceptance of responsibility for living modified organism (Japanese / English)

BRC mice in Publications

No Data