Strain Information | |
---|---|
Image | |
BRC No. | RBRC10184 |
Type | CRISPR/Cas9 |
Species | Mus musculus |
Strain name | B6D2-Izumo1<em1Nino> |
Former Common name | Izumo1-KO, IZUMO1_v1 KO |
H-2 Haplotype | |
ES Cell line | |
Background strain | |
Appearance | |
Strain development | Developed by Takako Saito・Naokazu Inoue, Fukushima Medical University in 2017. B6D2 genetic background. |
Strain description | Izumo1 mutant mice. 9 bp deletion including a translation initiation codon. Izumo1<em1Nino>: 9 bp deletion,ATCCTCTGGCGGTGCTGGCAAGCTGTGCGTTCTGGCCTTCATGGGGCCGCATTTTACACT |
Colony maintenance | |
References | Sci. Rep., 9(1):3151 (2019). 30816314 Nature, 434, 234-238 (2005). 15759005 |
Health Report | |
---|---|
Examination Date / Room / Rack |
Gene | |
---|---|
Gene info | Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter |
Ordering Information | |
---|---|
Donor DNA | |
Research application | |
Specific Term and Conditions | Prior to requesting the BIOLOGICAL RESOURCE, the RECIPIENT must obtain approval from the DEPOSITOR using the Approval Form. |
Depositor | Naokazu Inoue (Fukushima Medical University) |
Strain Status | Frozen sperm |
Strain Availability | Recovered litters from cryopreserved sperm (2 to 4 months) Cryopreserved sperm (within 1 month) |
Additional Info. | Necessary documents for ordering: |
BRC mice in Publications |
---|
No Data |