Strain Data Sheet

RBRC10096

Information1

Image
BRC No.RBRC10096
TypeCRISPR/Cas9Cartagena
SpeciesMus musculus
Strain nameC57BL/6J-Hr<em1Utr>
Former Common nameHrem1Utr/em1Utr
H-2 Haplotype
ES Cell line
Background strain
Appearance
Strain developmentDeveloped by Fumihiro Sugiyama and his colleague, Laboratory animal resource center, University of Tsukuba in 2014. With the CRISPR/Cas9, 5 bp deletion was introduced into exon 3 of Hr (hairless) gene. C57BL/6J genetic background.
Strain descriptionMutant strain harboring c.63_67delCGGCA mutation in the Hr (hairless) gene. Homozygous mutant shows the hairless phenotype starting around 3 weeks old. Hr<em1Utr>; 5 bp deletion at exon 3AGCCCCTGTGAACGGCATTGTGGG
Colony maintenance
ReferencesExp. Anim., 66(4):437-445 (2017). 28717054

Health Report

Examination Date / Room / Rack2023/02/27Room:4-BRack:G
2022/11/29Room:4-BRack:G
2022/05/09Room:2-検Rack:C
2022/02/21Room:2-検Rack:C
2021/11/22Room:2-検Rack:C
2021/08/23Room:2-検Rack:C

Gene

Gene info
Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Hrhairless14Hr<em1Utr>endonuclease-mediated mutation 1, University of Tsukuba Laboratory Animal Resource Center

Information2

Donor DNApX330-U6-Chimeric_BB-CBh-hSpCas9[human U6 promoter, S. pyogenes gRNA scaffold, human U6 terminator, CMV,chicken hybrid CMV enhancer/chicken beta-actin promotor (CBh), Synthetic DNA 3xFLAG, SV40 nuclear localization signal(NLS), Streptococcus pyogenes SpCas9* (human codon-optimized), bovine GH polyA signal, AAV2 inverted terminal repeat (ITR), f1 phage f1 origin, E. coli Ampicillin resistance gene (AmpR), E. coli pUC origin]* Not detected by PCR using Marker Gene Detection kit (TOYOBO, Osaka, Japan). Other introduced genes were not tested.
Research application
Specific Term and ConditionsIn publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Exp Anim. 2017 Jul 18. doi: 10.1538/expanim.17-0049.
DepositorFumihiro Sugiyama (University of Tsukuba)
Strain Statusan icon for Live miceLive mice
an icon for Frozen embryosFrozen embryos
an icon for Frozen spermFrozen sperm
Strain AvailabilityCryopreserved sperm (within 1 month)
Cryopreserved embryos (within 1 month)
Live mouse (3 to 6 months)
Additional Info.Mouse of the Month Feb 2020
Necessary documents for ordering:
  1. Order form (Japanese / English)
  2. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
  3. Acceptance of responsibility for living modified organism (Japanese / English)

Genotyping protocol -PCR-

BRC mice in Publications

No Data