Strain Data Sheet
RBRC10057
Information1 | |
|---|---|
| Image | |
| BRC No. | RBRC10057 |
| Type | Spontaneous Mutation Congenic |
| Species | Mus musculus |
| Strain name | B6.Cg-Eif2b5<toy> |
| Former Common name | B6Toy, Eif2b5<I98M> |
| H-2 Haplotype | |
| ES Cell line | |
| Background strain | |
| Appearance | |
| Strain development | Developed by Mika Tsujita, Brain Research Institute, Niigata University in 2008. Point mutation was identified in 2012. C57BL/6 genetic background. |
| Strain description | Spontaneous mutants exhibiting phenotypes similar to the Vanishing white matter disease. A point mutation (I98M) in the Eif2b5 (eukaryotic translation initiation factor 2B, subunit 5 epsilon) gene. Homozygous mutants show decreased body weight (starting around 3 weeks old) and impaired motor coordination. Homozygous mice are infertile, but sperms can be used for in vitro fertilization. WT: GCTGCTCAGATCAAAGAACACTTAToy: GCTGCTCAGATGAAAGAACACTTA |
| Colony maintenance | |
| References | J. Neurochem., 154(1):25-40 (2020). 31587290 |
Health Report | |
|---|---|
| Examination Date / Room / Rack | 2023/02/20Room:4-ARack:D 2022/11/21Room:4-ARack:D 2022/08/22Room:4-ARack:D 2022/05/23Room:4-ARack:D |
Gene | |
|---|---|
| Gene info | Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Eif2b5eukaryotic translation initiation factor 2B, subunit 5 epsilon16Eif2b5<toy>eukaryotic translation initiation factor 2B, subunit 5 epsilon; toyEif2b5^I98M |
Information2 | |
|---|---|
| Donor DNA | |
| Research application | |
| Specific Term and Conditions | In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. J. Neurochem., 154(1):25-40 (2020). |
| Depositor | Mika Terumitsu-Tsujita (Niigata University) |
| Strain Status |  Live mice Frozen embryos Frozen sperm |
| Strain Availability | Cryopreserved sperm (within 1 month) Live mouse (3 to 6 months) |
| Additional Info. | Necessary documents for ordering:
Genotyping protocol -PCR- |
BRC mice in Publications |
|---|
| No Data |