Strain Information | |
---|---|
Image | |
BRC No. | RBRC09966 |
Type | CRISPR/Cas9 |
Species | Mus musculus |
Strain name | STOCK Spata16<em1(R284Q)Osb> |
Former Common name | Spata16<R284Q/R284Q> |
H-2 Haplotype | |
ES Cell line | |
Background strain | |
Appearance | |
Strain development | Developed by Yoshitaka Fujihara and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2015. EGR-G01 ES cells derived from (129S2 x B6Cr)F1 were used. Mice were backcrossed to BDF1 for several generations. Mixed genetic background. |
Strain description | Spata16 point mutant (R284Q) mice generated by the CRISPR/Cas9 technique. Point mutation at exon 4.Spata16<em1(R284Q)Osb>: Point mutation at exon 4.ctacgtcagtgctgccaagtagcttttatgatgcaaacttaatttgtttttcaatcatgctggattgcttgtcttctctgacgaatcacagaagagttctcatttattagttcattttaagatgatattgaaaattgaatacatgtgattacgttcctctacacttctggtaattgtcctttaaggatctaatggcatttgtatttccttcatctttttacagGAGTATTGTTTTAAACCCAGCCTATTTCCGAAACCATCTTCGTCAGGCAGCCGTGTTTAGATGTCTGGAGAGATACTCAGAAGCTGCCC(G TO A)gtatgtttgttacaactttctgaagatttatttaaagttaaattaattttaccctcagattctggtaatagcataagaggacattccatttctctcatggaatatgattttatccgaattattgtcttataaatgtcaagccaacaattattgagtatctttttctttaattaaagctatttcatgttcatagctcttagcaaaattcaaactttccagccatgaggtcattagtgatgatgg |
Colony maintenance | |
References | Int. J. Mol. Sci. 2017, 18, 2208; doi:10.3390/ijms18102208 29065458 |
Health Report | |
---|---|
Examination Date / Room / Rack |
Gene | |
---|---|
Gene info | Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Spata16spermatogenesis associated 163Spata16<em1(R284Q)Osb>endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University |
Ordering Information | |
---|---|
Donor DNA | human hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized), crRNA, tracrRNA, Escherichia coli ampicillin resistant gene, Streptomyces albonigerpuromycin resistant gene Escherichia coliLac Z, T7 phage T7 promoter Escherichia coli lac promoter, Mousea part of Spata16 gene, Mouse PGK promoter |
Research application | |
Specific Term and Conditions | The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Int. J. Mol. Sci. 2017, 18, 2208; doi:10.3390/ijms18102208 RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
Depositor | Masahito Ikawa (Osaka University) |
Strain Status | Frozen sperm |
Strain Availability | Recovery and QC required prior to distribution |
Additional Info. | Necessary documents for ordering:
|
BRC mice in Publications |
---|
No Data |