Strain Data Sheet

RBRC09966

Strain Information

Image
BRC No.RBRC09966
TypeCRISPR/Cas9Cartagena
SpeciesMus musculus
Strain nameSTOCK Spata16<em1(R284Q)Osb>
Former Common nameSpata16<R284Q/R284Q>
H-2 Haplotype
ES Cell lineEGR-G01 [129S2 x C57BL/6NCr-Tg(CAG/Acr-EGFP)]
Background strain
Appearance
Strain developmentDeveloped by Yoshitaka Fujihara and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2015. EGR-G01 ES cells derived from (129S2 x B6Cr)F1 were used. Mice were backcrossed to BDF1 for several generations. Mixed genetic background.
Strain descriptionSpata16 point mutant (R284Q) mice generated by the CRISPR/Cas9 technique. Point mutation at exon 4.Spata16<em1(R284Q)Osb>: Point mutation at exon 4.ctacgtcagtgctgccaagtagcttttatgatgcaaacttaatttgtttttcaatcatgctggattgcttgtcttctctgacgaatcacagaagagttctcatttattagttcattttaagatgatattgaaaattgaatacatgtgattacgttcctctacacttctggtaattgtcctttaaggatctaatggcatttgtatttccttcatctttttacagGAGTATTGTTTTAAACCCAGCCTATTTCCGAAACCATCTTCGTCAGGCAGCCGTGTTTAGATGTCTGGAGAGATACTCAGAAGCTGCCC(G TO A)gtatgtttgttacaactttctgaagatttatttaaagttaaattaattttaccctcagattctggtaatagcataagaggacattccatttctctcatggaatatgattttatccgaattattgtcttataaatgtcaagccaacaattattgagtatctttttctttaattaaagctatttcatgttcatagctcttagcaaaattcaaactttccagccatgaggtcattagtgatgatgg
Colony maintenance
ReferencesInt. J. Mol. Sci. 2017, 18, 2208; doi:10.3390/ijms18102208 29065458

Health Report

Examination Date / Room / Rack

Gene

Gene info
Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Spata16spermatogenesis associated 163Spata16<em1(R284Q)Osb>endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University

Ordering Information

Donor DNAhuman hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized), crRNA, tracrRNA, Escherichia coli ampicillin resistant gene, Streptomyces albonigerpuromycin resistant gene Escherichia coliLac Z, T7 phage T7 promoter Escherichia coli lac promoter, Mousea part of Spata16 gene, Mouse PGK promoter
Research application
Specific Term and ConditionsThe RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Int. J. Mol. Sci. 2017, 18, 2208; doi:10.3390/ijms18102208 RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
DepositorMasahito Ikawa (Osaka University)
Strain Statusan icon for Frozen spermFrozen sperm
Strain AvailabilityRecovery and QC required prior to distribution
Additional Info.Necessary documents for ordering:
  1. Approval form (Japanese / English)
  2. Order form (Japanese / English)
  3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
  4. Acceptance of responsibility for living modified organism (Japanese / English)
Lab HP

BRC mice in Publications

No Data