Strain Data Sheet

RBRC09844

Strain Information

Image
BRC No.RBRC09844
TypeCRISPR/Cas9Cartagena
SpeciesMus musculus
Strain nameB6D2-Cd160<em1Osb>
Former Common nameCD160<-20/-20>
H-2 Haplotype
ES Cell line
Background strain
Appearance
Strain developmentDeveloped by Daiji Kiyozumi, Masashi Mori and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2015. BDF1 background.
Strain descriptionCD160 mutant mice generated by the CRISPR/Cas9 technique. 20 bp deletion at Exon 2.CD160<em1Osb>, [Deleted sequence]:CCCCTGGCCA[AAGCTGCTGTGCCCTGGCCA]TCCTGCTGGC
Colony maintenance
ReferencesCells. 2020 Mar 28;9(4). pii: E821. 32231122

Health Report

Examination Date / Room / Rack

Gene

Gene info
Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Cd160CD160 antigen3Cd160<em1Osb>endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University

Ordering Information

Donor DNAhuman hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized), crRNA, tracrRNA, Escherichia coli ampicillin resistant gene, Mouse a part of CD160 gene
Research application
Specific Term and ConditionsThe RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Cells. 2020 Mar 28;9(4). pii: E821.RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
DepositorMasahito Ikawa (Osaka University)
Strain Statusan icon for Frozen spermFrozen sperm
Strain AvailabilityRecovery and QC required prior to distribution
Additional Info.Necessary documents for ordering:
  1. Approval form (Japanese / English)
  2. Order form (Japanese / English)
  3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
  4. Acceptance of responsibility for living modified organism (Japanese / English)
Lab HP

BRC mice in Publications

No Data