Strain Data Sheet

RBRC09843

Strain Information

Image
BRC No.RBRC09843
TypeCRISPR/Cas9 (Transgene)Cartagena
SpeciesMus musculus
Strain nameSTOCK Del(9Gm17677-Gm17689)1Osb
Former Common namePateN-G<-841 kb/wt>
H-2 Haplotype
ES Cell lineEGR-G01 [129S2 x C57BL/6NCr-Tg(CAG/Acr-EGFP)]
Background strain
Appearance
Strain developmentDeveloped by Taichi Noda and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2015. EGR-G01 ES cell was used to generate chimera mice. Mice were further crossed with B6D2F1. Mixed genetic background.
Strain descriptionMutant mice generated by the CRISPR/Cas9 technique. 841 kb deletion at chromosome 9.Del(9Gm17677-Gm17689)1Osb, [Deleted sequence]:AGGAGTACTGATTTTGTACAAGT[ctcattcaatgggtgagtgtaat (about 841 kb deletion) caggagtatcaagaggtattttccaattgcagt]GGGATCCTAGGAG
Colony maintenance
References
Identification of multiple male reproductive tract-specific proteins that regulate sperm migration through the oviduct in mice.
Fujihara Y, Noda T, Kobayashi K, Oji A, Kobayashi S, Matsumura T, Larasati T, Oura S, Kojima-Kita K, Yu Z, Matzuk M M, Ikawa M
Proc. Natl. Acad. Sci. USA, 116(37):18498-18506 (2019). 31455729

Health Report

Examination Date / Room / Rack

Gene

Gene SymbolGene NameChr.Allele SymbolAllele NameCommon NamesPromoterDiseases Related to This Gene
Gm17677
MGI:4937311		predicted gene, 176779Gm17677
Gm17689
MGI:4937323		predicted gene, 176899Gm17689

Phenotype

Phenotype annotation from literatures by Mammalian phenotype ontology
  • abnormal spermatogenesis (MP:0001156)

  • impaired acrosome reaction (MP:0004542)

  • impaired sperm capacitation (MP:0003666)

  • reduced male fertility (MP:0001922)

  • reproductive system phenotype (MP:0005389)
    • Detailed phenotype data

    Ordering Information

    Donor DNAhuman hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized), crRNA, tracrRNA, Escherichia coli ampicillin resistance gene, Mouse a part of PateN-PateG gene, jellyfish GFP cDNA
    Research application
    Specific Term and ConditionsThe RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Proc Natl Acad Sci U S A. 2019 Sep 10;116(37):18498-18506. doi: 10.1073/pnas.1908736116.RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
    DepositorMasahito Ikawa (Osaka University)
    Strain Statusan icon for Frozen spermFrozen sperm
    Strain AvailabilityRecovery and QC required prior to distribution
    Additional Info.Necessary documents for ordering:
    1. Approval form (Japanese / English)
    2. Order form (Japanese / English)
    3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
    4. Acceptance of responsibility for living modified organism (Japanese / English)
    Lab HP, Co-creation Bureau, Osaka University HP

    BRC mice in Publications

    No Data