Strain Data Sheet

RBRC09824

Strain Information

Image
BRC No.RBRC09824
TypeCRISPR/Cas9 (Transgene)Cartagena
SpeciesMus musculus
Strain nameB6D2;B6-Ube2d2b<em1Osb>
Former Common nameUbe2d2b <-397/-397>
H-2 Haplotype
ES Cell lineEGR-G101 [C57BL/6NCr-Tg(CAG/Acr-EGFP)C3-N01-FJ002Osb]
Background strain
Appearance
Strain developmentDeveloped by Asami Oji and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2015. Mixed genetic background. EGR-G101 ES cell was used. Mice were crossed with B6D2.
Strain descriptionTktl1 mutant mice generated by the CRISPR/Cas9 technique. Ube2d2b<em1Osb> [Deleted sequence]: 397 bp deletion at Exon 1. aggccagaactgcctgcctcctcttctgcggctgatccaaaaccagcaaggcagccccaggccctcggtgcctgcctccttccacctggggcctaccaagacagccttccaccatggctctgaagagaatccacaa[ggaactgaacgacctggcccaggatcccccagcacagtgttcagcaggtcctgtcggggaagatatgtttcactggcaagctacaatcatggggccaaatgatagtccctatcagggcggagcatttttcttgacaattgatttcccaacagagtaccccttcaaaccacctaaggttgaatttacaacaagaatttatcatccaaatgttaacagtaacggcagtatttgtcttgatattcttcggtcacagtggtctccagcactaactatttccaaagtacttttgtccatcagttctctgttgtgtgaccccaatccagatgatcccttagtgcctgagattgctcagatctacaaaacagatagagacaagtacaacagaacagctcgggaa]tggactcagaaatatgcgatgtgactaaagagaatactggatatcctctacaaataaaagctaggggaactctgaaagagaagttcttttgattcccaccggactgtttcccatg
Colony maintenance
References
CRISPR/Cas9-mediated genome editing reveals 30 testis-enriched genes dispensable for male fertility in micedagger.
Lu Y, Oura S, Matsumura T, Oji A, Sakurai N, Fujihara Y, Shimada K, Miyata H, Tobita T, Noda T, Castaneda J M, Kiyozumi D, Zhang Q, Larasati T, Young S A M, Kodani M, Huddleston C A, Robertson M J, Coarfa C, Isotani A, Aitken R J, Okabe M, Matzuk M M, Garcia T X, Ikawa M
Biol. Reprod., 101(2):501-511 (2019). 31201419

Health Report

Examination Date / Room / Rack

Gene

Gene SymbolGene NameChr.Allele SymbolAllele NameCommon NamesPromoterDiseases Related to This Gene
Ube2d2b
MGI:1920568		ubiquitin-conjugating enzyme E2D 2B5Ube2d2b<em1Osb> endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University

Phenotype

Annotation by Mammalian phenotyhpe ontology
  • reproductive system phenotype(MP:0005389)
    • Detailed phenotype data

    Ordering Information

    Donor DNAhuman hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized), crRNA, tracrRNA, Escherichia coli ampicillin resistance gene, Mouse a part of Ube2d2b gene, jellyfish GFP cDNA
    Research application
    Specific Term and ConditionsThe RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Biol. Reprod., 101(2):501-511 (2019).RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
    DepositorMasahito Ikawa (Osaka University)
    Strain Statusan icon for Frozen spermFrozen sperm
    Strain AvailabilityRecovery and QC required prior to distribution
    Additional Info.Necessary documents for ordering:
    1. Approval form (Japanese / English)
    2. Order form (Japanese / English)
    3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
    4. Acceptance of responsibility for living modified organism (Japanese / English)
    Lab HP, Co-creation Bureau, Osaka University HP

    BRC mice in Publications

    No Data