Strain Data Sheet

RBRC09789

Strain Information

Image
BRC No.RBRC09789
TypeCRISPR/Cas9Cartagena
SpeciesMus musculus
Strain nameB6D2-Armc12<em1Osb>
Former Common nameArmc12-8/wt
H-2 Haplotype
ES Cell line
Background strain
Appearance
Strain developmentDeveloped by Haruhiko Miyata and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2015. BDF1 background.
Strain descriptionArmc12 mutant mice generated by the CRISPR/Cas9 technique. 8 bp deletion.Armc12<em1Osb> [Deleted sequence]:Intron/Exon 1 junctiongctgattctagtaccctggttctgggccctgccagggttctggttctagaatgttctctccaggcctagc[tcctacct]AGCCACAAGGCAGCACGGAAGACATGGGCAAGACCATTCCCCGGTTCCTGGAGCAACTGGACCTCATCAAAAGCTTCGTGGGCCTGGCTACAGGCGCCGGGGCCTTATACCTGCTGTAC
Colony maintenance
ReferencesProc. Natl. Acad. Sci. USA, 118(6):e2018355118 (2021). 33542098

Health Report

Examination Date / Room / Rack

Gene

Gene info
Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Armc12armadillo repeat containing 1217Armc12<em1Osb>endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University

Ordering Information

Donor DNAhuman hU6 promoter, CMV enhancer (CBh), chicken chicken beta-actin promoter (CBh), SV40 nuclear localization signal, Streptococcus pyogenes SpCas9 (human codon-optimized), crRNA, tracrRNA, Escherichia coli ampicillin resistant gene, Mouse a part of Armc12 gene
Research application
Specific Term and ConditionsThe RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Proc Natl Acad Sci U S A. 2021 Feb 9;118(6):e2018355118.RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again.
DepositorMasahito Ikawa (Osaka University)
Strain Statusan icon for Frozen spermFrozen sperm
Strain AvailabilityRecovery and QC required prior to distribution
Additional Info.Necessary documents for ordering:
  1. Approval form (Japanese / English)
  2. Order form (Japanese / English)
  3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
  4. Acceptance of responsibility for living modified organism (Japanese / English)
Lab HP

BRC mice in Publications

No Data