Strain Data Sheet

RBRC10387

Information1

Image
BRC No.RBRC10387
TypeCRISPR/Cas9 (Transgene)Cartagena
SpeciesMus musculus
Strain nameC57BL/6-Pld2<em1Yaka>
Former Common namePLD2-KO (CRISPR/Cas9)
H-2 Haplotype
ES Cell line
Background strain
Appearance
Strain developmentDeveloped by Yasunori Kanaho and NGO THAI BICH VAN, University of Tsukuba in 2016. This strain was generated using fertilized eggs derived from C57BL/6J with the CRISPR/Cas9.
Strain descriptionPld2 (phospholipase D2) mutant mice generated by the CRISPR/Cas9. Stop codon was introduced at Exon 3 of the Pld2 gene. Pld2<em1Yaka>:gcctctgaaagcacaccccttggtgttcg(AATTCGACTACAAAGACGATGACGACAAGTGATTGACTAGG)cccctggggtccctgttat
Colony maintenance
ReferencesSci. Rep., 8(1) 6283 (2018). 29674728

Health Report

Examination Date / Room / Rack

Gene

Gene info
Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Pld2phospholipase D211Pld2<em1Yaka>endonuclease-mediated mutation 1, Yasunori Kanaho

Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
FLAGFLAG tag (synthetic)11FLAG

Information2

Donor DNApX330-U6-Chimeric_BB-CBh-hSpCas9[human U6 promoter, S. pyogenes gRNA scaffold, human U6 terminator, CMV,chicken hybrid CMV enhancer/chicken beta-actin promotor (CBh), Synthetic DNA 3xFLAG, SV40 nuclear localization signal(NLS), Streptococcus pyogenes SpCas9 (human codon-optimized), bovine GH polyA signal, AAV2 inverted terminal repeat (ITR), f1 phage f1 origin, E. coli Ampicillin resistance gene (AmpR), E. coli pUC origin], FLAG tag sequence (synthetic)
Research application
Specific Term and ConditionsIn publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Sci. Rep., 8(1), 6283 (2018).In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. The availability of the BIOLOGICAL RESOURCE is limited to a RECIPIENT of a not-for profit institution for a not-for-profit research.
DepositorYasunori Kanaho (University of Tsukuba)
Strain Statusan icon for Frozen embryosFrozen embryos
an icon for Frozen spermFrozen sperm
Strain AvailabilityRecovered litters from cryopreserved sperm (2 to 4 months)
Cryopreserved sperm (within 1 month)
Additional Info.Necessary documents for ordering:
  1. Order form (Japanese / English)
  2. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
  3. Acceptance of responsibility for living modified organism (Japanese / English)

Genotyping protocol -PCR-

BRC mice in Publications

No Data