Strain Information | |
---|---|
Image | |
BRC No. | RBRC10246 |
Type | Targeted Mutation![]() |
Species | Mus musculus |
Strain name | B6.129P2-Avil<tm2(cre)Faw> |
Former Common name | Advillin-Cre mice, B6.129P2-Avil<tm2(cre)Faw> |
H-2 Haplotype | |
ES Cell line | E14 [129P2/OlaHsd] |
Background strain | |
Appearance | |
Strain development | The line SHOULD be maintained as male heterozygous, homozygous or female advillin-Cre mice have leaky Cre expression.E14 ES cells were used to generate this strain, and then mice were crossed to C57BL/6J.Number of backcrossing to C57BL/6J:unknown. |
Strain description | Cre was knocked into exon 2 of the Avil locus. |
Colony maintenance | |
References | Proc. Natl. Acad. Sci. USA, 107(20), 9424-9429 (2010). 20439739 |
Health Report | |
---|---|
Examination Date / Room / Rack |
Gene | |
---|---|
Gene info | Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter EGFPEnhanced Green Fluorescent Protein (Aequorea victoria)10EGFP Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Flpyeast flippase recombinase10Flpmouse Ace promoter Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter FrtFrt, truncated, non-functional(GAAGTTCCTATTCCGAAGTTCCTATTC)10Frt Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter FrtFrt, truncated, non-functional(GAAGTTCCTATTCCGAAGTTCCTATTC)10Frt Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter GHGrowth hormone polyA (Bovine)10GH Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Iresinternal ribosomal entry site (EMCV)10 Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter crePhage P1 Cre recombinase10cre Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter neoneomycin resistance gene10mouse Polr2a promoter Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter HSV thymidine kinase polyA signal10 |
Ordering Information | |
---|---|
Donor DNA | Phage P1 Cre recombinase, Encephalomyocarditis virus (EMCV) internal ribosomal entry site (ires), jellyfish GFP cDNA, Bovine Growth Hormone polyA, mouse Ace genomic DNA, yeast Flp cDNA, HSV thymidine kinase polyA signal, mouse Polr2a promoter, E. coli Neomycin resistance gene, mouse Avil genomic DNA, yeast Frt, truncated, non-functional(GAAGTTCCTATTCCGAAGTTCCTATTC) |
Research application | Cre/loxP system FLP/frt system Fluorescent Proteins/lacZ System |
Specific Term and Conditions | In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Proc. Natl. Acad. Sci., U S A, 107(20), 9424-9429(2010).The BIOLOGICAL RESOURCE is solely for research use by nonprofit institutes only. The RECIPIENT of a for-profit organization must first obtain a use license from the DEPOSITOR. Depositor shall notify RIKEN BRC of its written consent within (10) days of execution of any use license for the BIOLOGICAL RESOURCE. It shall be the sole responsibility of Depositor to obtain and enforce any use licenses. |
Depositor | Fan Wang (Duke University) |
Strain Status | ![]() ![]() |
Strain Availability | Recovered litters from cryopreserved embryos (2 to 4 months) Cryopreserved sperm (within 1 month) Cryopreserved embryos (within 1 month) |
Additional Info. | Necessary documents for ordering:
Genotyping protocol -PCR- |
BRC mice in Publications |
---|
No Data |