Strain Data Sheet

RBRC10246

Strain Information

Image
BRC No.RBRC10246
TypeTargeted MutationCartagena
SpeciesMus musculus
Strain nameB6.129P2-Avil<tm2(cre)Faw>
Former Common nameAdvillin-Cre mice, B6.129P2-Avil<tm2(cre)Faw>
H-2 Haplotype
ES Cell lineE14 [129P2/OlaHsd]
Background strain
Appearance
Strain developmentThe line SHOULD be maintained as male heterozygous, homozygous or female advillin-Cre mice have leaky Cre expression.E14 ES cells were used to generate this strain, and then mice were crossed to C57BL/6J.Number of backcrossing to C57BL/6J:unknown.
Strain descriptionCre was knocked into exon 2 of the Avil locus.
Colony maintenance
References
Deletion of PIK3C3/Vps34 in sensory neurons causes rapid neurodegeneration by disrupting the endosomal but not the autophagic pathway.
Zhou X, Wang L, Hasegawa H, Amin P, Han B X, Kaneko S, He Y, Wang F
Proc. Natl. Acad. Sci. USA, 107(20), 9424-9429 (2010). 20439739

Health Report

Examination Date / Room / Rack

Gene

Gene SymbolGene NameChr.Allele SymbolAllele NameCommon NamesPromoterDiseases Related to This Gene
Avil
MGI:1333798
advillin10Avil<tm2(cre)Fawa>
MGI:4459942
targeted mutation 2, Fan Wang
  • nephrotic syndrome, type 21(MedGEN)
  • EGFP Enhanced Green Fluorescent Protein (Aequorea victoria)10EGFP
    Flp yeast flippase recombinase10Flp mouse Ace promoter
    Frt Frt, truncated, non-functional(GAAGTTCCTATTCCGAAGTTCCTATTC)10Frt
    Frt Frt, truncated, non-functional(GAAGTTCCTATTCCGAAGTTCCTATTC)10Frt
    GH Growth hormone polyA (Bovine)10GH
    Ires internal ribosomal entry site (EMCV)10
    cre Phage P1 Cre recombinase10cre
    neo neomycin resistance gene10 mouse Polr2a promoter
    HSV thymidine kinase polyA signal10

    Phenotype

    Annotation by Mammalian phenotyhpe ontology
  • abnormal axon extension(MP:0003651)

  • abnormal dorsal root ganglion morphology(MP:0000961)

  • abnormal mechanical nociception(MP:0002734)

  • abnormal neurite morphology(MP:0008415)

  • allodynia(MP:0003177)
  • more 2 phenotypes
  • decreased thermal nociceptive threshold(MP:0003998)

  • increased susceptibility to experimental autoimmune encephalomyelitis(MP:0004799)
  • Detailed phenotype data

    Ordering Information

    Donor DNAPhage P1 Cre recombinase, Encephalomyocarditis virus (EMCV) internal ribosomal entry site (ires), jellyfish GFP cDNA, Bovine Growth Hormone polyA, mouse Ace genomic DNA, yeast Flp cDNA, HSV thymidine kinase polyA signal, mouse Polr2a promoter, E. coli Neomycin resistance gene, mouse Avil genomic DNA, yeast Frt, truncated, non-functional(GAAGTTCCTATTCCGAAGTTCCTATTC)
    Research applicationCre/loxP system
    FLP/frt system
    Fluorescent Proteins/lacZ System
    Specific Term and ConditionsIn publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Proc. Natl. Acad. Sci., U S A, 107(20), 9424-9429(2010). The BIOLOGICAL RESOURCE is solely for research use by nonprofit institutes only. The RECIPIENT of a for-profit organization must first obtain a use license from the DEPOSITOR. Depositor shall notify RIKEN BRC of its written consent within (10) days of execution of any use license for the BIOLOGICAL RESOURCE. It shall be the sole responsibility of Depositor to obtain and enforce any use licenses.
    DepositorFan Wang (Duke University)
    Strain Statusan icon for Frozen embryosFrozen embryos
    an icon for Frozen spermFrozen sperm
    Strain AvailabilityRecovered litters from cryopreserved embryos (2 to 4 months)
    Cryopreserved sperm (within 1 month)
    Cryopreserved embryos (within 1 month)
    Additional Info.Necessary documents for ordering:
    1. Order form (Japanese / English)
    2. Category I MTA: MTA for distribution with RIKEN BRC (Japanese / English)
    3. Acceptance of responsibility for living modified organism (Japanese / English)

    Genotyping protocol -PCR-

    BRC mice in Publications

    Yoshioka N, Kurose M, Sano H, Tran DM, Chiken S, Tainaka K, Yamamura K, Kobayashi K, Nambu A, Takebayashi H.
    Sensory-motor circuit is a therapeutic target for dystonia musculorum mice, a model of hereditary sensory and autonomic neuropathy 6.
    Sci Adv 10(30) eadj9335(2024) 39058787