Strain Information | |
|---|---|
| Image | |
| BRC No. | RBRC10246 |
| Type | Targeted Mutation |
| Species | Mus musculus |
| Strain name | B6.129P2-Avil<tm2(cre)Faw> |
| Former Common name | Advillin-Cre mice, B6.129P2-Avil<tm2(cre)Faw> |
| H-2 Haplotype | |
| ES Cell line | E14 [129P2/OlaHsd] |
| Background strain | |
| Appearance | |
| Strain development | The line SHOULD be maintained as male heterozygous, homozygous or female advillin-Cre mice have leaky Cre expression.E14 ES cells were used to generate this strain, and then mice were crossed to C57BL/6J.Number of backcrossing to C57BL/6J:unknown. |
| Strain description | Cre was knocked into exon 2 of the Avil locus. |
| Colony maintenance | |
| References | Deletion of PIK3C3/Vps34 in sensory neurons causes rapid neurodegeneration by disrupting the endosomal but not the autophagic pathway. Zhou X, Wang L, Hasegawa H, Amin P, Han B X, Kaneko S, He Y, Wang F Proc. Natl. Acad. Sci. USA, 107(20), 9424-9429 (2010). 20439739Sci. Adv., 10(30):eadj9335 (2024). 39058787 |
Health Report | |
|---|---|
| Examination Date / Room / Rack | |
Gene | |||||||
|---|---|---|---|---|---|---|---|
| Gene Symbol | Gene Name | Chr. | Allele Symbol | Allele Name | Common Names | Promoter | Diseases Related to This Gene |
| Avil MGI:1333798 | advillin | 10 | Avil<tm2(cre)Fawa> MGI:4459942 | targeted mutation 2, Fan Wang | |||
| EGFP | Enhanced Green Fluorescent Protein (Aequorea victoria) | 10 | EGFP | ||||
| Flp | yeast flippase recombinase | 10 | Flp | mouse Ace promoter | |||
| Frt | Frt, truncated, non-functional(GAAGTTCCTATTCCGAAGTTCCTATTC) | 10 | Frt | ||||
| Frt | Frt, truncated, non-functional(GAAGTTCCTATTCCGAAGTTCCTATTC) | 10 | Frt | ||||
| GH | Growth hormone polyA (Bovine) | 10 | GH | ||||
| Ires | internal ribosomal entry site (EMCV) | 10 | |||||
| cre | Phage P1 Cre recombinase | 10 | cre | ||||
| neo | neomycin resistance gene | 10 | mouse Polr2a promoter | ||||
| HSV thymidine kinase polyA signal | 10 | ||||||
Phenotype | |
|---|---|
| Phenotype annotation from literatures by Mammalian phenotype ontology | more 2 phenotypes |
| Detailed phenotype data | |
Ordering Information | |
|---|---|
| Donor DNA | Phage P1 Cre recombinase, Encephalomyocarditis virus (EMCV) internal ribosomal entry site (ires), jellyfish GFP cDNA, Bovine Growth Hormone polyA, mouse Ace genomic DNA, yeast Flp cDNA, HSV thymidine kinase polyA signal, mouse Polr2a promoter, E. coli Neomycin resistance gene, mouse Avil genomic DNA, yeast Frt, truncated, non-functional(GAAGTTCCTATTCCGAAGTTCCTATTC) |
| Research application | Cre/loxP system FLP/frt system Fluorescent Proteins/lacZ System Cre driver |
| Specific Term and Conditions | In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Proc. Natl. Acad. Sci., U S A, 107(20), 9424-9429(2010). The BIOLOGICAL RESOURCE is solely for research use by nonprofit institutes only. The RECIPIENT of a for-profit organization must first obtain a use license from the DEPOSITOR. Depositor shall notify RIKEN BRC of its written consent within (10) days of execution of any use license for the BIOLOGICAL RESOURCE. It shall be the sole responsibility of Depositor to obtain and enforce any use licenses. |
| Depositor | Fan Wang (Duke University) |
| Strain Status | Frozen embryos Frozen sperm |
| Strain Availability | Recovered litters from cryopreserved embryos (2 to 4 months) Cryopreserved sperm (within 1 month) Cryopreserved embryos (within 1 month) |
| Additional Info. | Necessary documents for ordering:
Genotyping protocol -PCR- |
BRC mice in Publications |
|---|
Banerjee P, Sato T, Iwasato T. Generation and characterization of BAC transgenic mouse lines expressing a fluorescent protein in trigeminal and dorsal root ganglion neurons. PLoS One 20(6) e0321014(2025) 40478843 |
Yoshioka N, Kurose M, Sano H, Tran DM, Chiken S, Tainaka K, Yamamura K, Kobayashi K, Nambu A, Takebayashi H. Sensory-motor circuit is a therapeutic target for dystonia musculorum mice, a model of hereditary sensory and autonomic neuropathy 6. Sci Adv 10(30) eadj9335(2024) 39058787 |