Strain Data Sheet

RBRC10222

Information1

Image
BRC No.RBRC10222
TypeCRISPR/Cas9Cartagena
SpeciesMus musculus
Strain nameBALB/c-S100a9<em1Fjw>
Former Common nameMRP14-KO BALB/cA mice
H-2 Haplotype
ES Cell line
Background strainBALB/cAJcl
Appearance
Strain developmentDeveloped by Wataru Fujii and Yasuyuki Goto, The University of Tokyo in 2017. Fertilized eggs derived from BALB/cAJcl was used. BALB/cAJcl genetic background.
Strain descriptionS100a9 [S100 calcium binding protein A9 (calgranulin B)] mutant mice generated by the CRISPR/Cas9. 338 bp genomic fragment covering exon 2 was deleted. Deleted genomic sequence, (Chr 3: 90695035 to 90695372 (GRCm38.p4))TGGCCAGAGACTAGGTCAGGGAAGCTTGGTATCCCATTCTTTTATTTGTAACTTTTGTTTCCCCTATTTTCAAAGAAGAGCAAGAAGATGGCCAACAAAGCACCTTCTCAGATGGAGCGCAGCATAACCACCATCATCGACACCTTCCATCAATACTCTAGGAAGGAAGGACACCCTGACACCCTGAGCAAGAAGGAATTCAGACAAATGGTGGAAGCACAGTTGGCAACCTTTATGAAGGTGAGGCTTGGCTTGTGAGAGAAGAGGGTGCAATCTGCAGCAGTCTGAGAACAAATTCTAGCACCGGGGGCAGTAGGGCTCTGCCATTAGAGGCACTC
Colony maintenance
ReferencesImmunol. Lett., 194, 13-20 (2017). 29253495

Health Report

Examination Date / Room / Rack

Gene

Gene info
Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
S100a9S100 calcium binding protein A9 (calgranulin B)3S100a9<em1Fjw>endonuclease-mediated mutation 1, Wataru Fujii

Information2

Donor DNA
Research application
Specific Term and ConditionsIn publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Immunol. Lett., 194, 13-20 (2017).
DepositorYasuyuki Goto (The University of Tokyo)
Strain Statusan icon for Frozen embryosFrozen embryos
an icon for Frozen spermFrozen sperm
Strain AvailabilityRecovered litters from cryopreserved embryos (2 to 4 months)
Cryopreserved sperm (within 1 month)
Cryopreserved embryos (within 1 month)
Additional Info.Necessary documents for ordering:
  1. Order form (Japanese / English)
  2. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
  3. Acceptance of responsibility for living modified organism (Japanese / English)

Genotyping protocol -PCR-

BRC mice in Publications

No Data