Strain Data Sheet

RBRC10219

Information1

Image
BRC No.RBRC10219
TypeCRISPR/Cas9 (Transgene)Cartagena
SpeciesMus musculus
Strain nameB6.B6CB-Rnf31<tm1.1Kiwa> Ripk3<em1Kiwa>
Former Common nameConditional HOIP delta linear/RIP3 kcockout mice
H-2 Haplotype
ES Cell lineTT2 [(C57BL/6NCrlj x CBA/JNCrlj)F1]
Background strain
Appearance
Strain developmentDeveloped by Kazuhiro Iwai, Graduate School of Medicine and Faculty of Medicine Kyoto University. Rnf31 floxed mice(RBRC09483)was developed using the TT2 ES cell line [(C57BL/6 x CBA)F1]. A pair of loxP sites were flanking exons encoding a RING-IBR-RING domain. A FRT-flanked Neo resistance gene was deleted. C57BL/6 congenic strain. This strain was further modified with the CRISPR/Cas9, resulting in 7 bp deletion at Exon 3 of the Ripk3 gene.
Strain descriptionCompound mutant mice harboring floxed Rnf31 and 7 bp deletion at Exon 3 of Ripk3.Ripk3<em1Kiwa>: 7 bp deletion at Exon 3. ACCGAGTGCCCTCGGCCCTGG
Colony maintenance
ReferencesEMBO J, 32, 2463-2476 (2013). 23942237
J. Immunol., 200(10) 3438-3449 (2018). 29654209

Health Report

Examination Date / Room / Rack

Gene

Gene info
Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Rnf31ring finger protein 3114Rnf31<tm1.1Kiwa>targeted mutation 1.1, Kazuhiro Iwai

Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Ripk3receptor-interacting serine-threonine kinase 314Ripk3<em1Kiwa>endonuclease-mediated mutation 1, Kazuhiro Iwai

Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Frtyeast FRT (flippase recombination target) site14Frt

Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
loxPphage P1 loxP14loxP

Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
loxPphage P1 loxP14loxP

Information2

Donor DNAPhage P1 loxP sites, yeast FRT (flipase recombination target) site, mouse Rnf31 genomic DNA
Research applicationCre/loxP system
FLP/frt system
Specific Term and ConditionsPrior to requesting the BIOLOGICAL RESOURCE, the RECIPIENT must obtain approval from the DEPOSITOR using the Approval Form. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. 後日指定。The RECIPIENT agrees to use this BIOLOGICAL RESOURCE as a collaboration with the DEPOSITOR. For use of the BIOLOGICAL RESOURCE by a for-profit institution, the RECIPIENT must reach agreement on terms and conditions of use of it with DEPOSITOR and must obtain a prior written consent from the DEPOSITOR. The RECIPIENT must contact the DEPOSITOR in the case of application for any patents or commercial use based on the results from the use of the BIOLOGICAL RESOURCE.
DepositorKazuhiro Iwai (Kyoto University)
Strain Statusan icon for Frozen spermFrozen sperm
Strain AvailabilityRecovered litters from cryopreserved sperm (2 to 4 months)
Cryopreserved sperm (within 1 month)
Additional Info.Necessary documents for ordering:
  1. Approval form (Japanese / English)
  2. Order form (Japanese / English)
  3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
  4. Acceptance of responsibility for living modified organism (Japanese / English)

BRC mice in Publications

No Data