Strain Data Sheet

RBRC10100

Information1

Image
BRC No.RBRC10100
TypeCRISPR/Cas9Cartagena
SpeciesMus musculus
Strain nameC57BL/6-Riok3<em2Tsse>
Former Common nameRIOK3 KO Cr8/Cr8
H-2 Haplotype
ES Cell line
Background strainC57BL/6JJcl
Appearance
Strain developmentDeveloped by Ken Takashima and Hiroyuki Oshiumi, Graduate School of Medicine, Hokkaido University. With the CRISPR/Cas9, a frameshift mutation was introduced into exon 4 of the Riok3 gene. C57BL/6 genetic background. Homozygous mice are viable.
Strain descriptionRiok3 (RIO kinase 3) mutant mice. 8 base pairs deletion at Exon 4 causing the frameshift mutation. Lack of Riok3 protein was confirmed. Riok3<em2Tsse>; 8 bp deletion at exon 4ACAGCTCTGAAGACGAGGTTGACTGGCAGGACACT
Colony maintenance
ReferencesCell Rep.,11(2), 192-200 (2015). 25865883

Health Report

Examination Date / Room / Rack

Gene

Gene info
Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Riok3RIO kinase 318Riok3<em2Tsse>endonuclease-mediated mutation 2, Tsukasa Seya

Information2

Donor DNA
Research applicationImmunology and Inflammation Research
Specific Term and ConditionsPrior to requesting the BIOLOGICAL RESOURCE, the RECIPIENT must obtain approval from the DEPOSITOR using the Approval Form. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Cell Rep.,11(2), 192-200 (2015).
DepositorTsukasa Seya (Hokkaido University)
Strain Statusan icon for Frozen spermFrozen sperm
Strain AvailabilityRecovered litters from cryopreserved sperm (2 to 4 months)
Cryopreserved sperm (within 1 month)
Additional Info.Necessary documents for ordering:
  1. Approval form (Japanese / English)
  2. Order form (Japanese / English)
  3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
  4. Acceptance of responsibility for living modified organism (Japanese / English)

BRC mice in Publications

No Data