Strain Information | |
|---|---|
| Image | |
| BRC No. | RBRC10058 |
| Type | Spontaneous Mutation Congenic |
| Species | Mus musculus |
| Strain name | C3H.Cg-Eif2b5<toy> |
| Former Common name | C3HToy, Eif2b5<I98M> |
| H-2 Haplotype | |
| ES Cell line | |
| Background strain | C3H/HeNCrl |
| Appearance | |
| Strain development | Developed by Mika Tsujita, Brain Research Institute, Niigata University in 2008. Point mutation was identified in 2012. C3H/HeN genetic background. |
| Strain description | Spontaneous mutants exhibiting phenotypes similar to the Vanishing white matter disease. A point mutation (I98M) in the Eif2b5 (eukaryotic translation initiation factor 2B, subunit 5 epsilon) gene. Homozygous mutants show decreased body weight (starting around 3 weeks old) and impaired motor coordination. Homozygous mice are infertile, but sperms can be used for in vitro fertilization. WT: GCTGCTCAGATCAAAGAACACTTAToy: GCTGCTCAGATGAAAGAACACTTA |
| Colony maintenance | |
| References | Glial pathology in a novel spontaneous mutant mouse of the Eif2b5 gene: a vanishing white matter disease model. Terumitsu-Tsujita M, Kitaura H, Miura I, Kiyama Y, Goto F, Muraki Y, Ominato S, Hara N, Simankova A, Bizen N, Kashiwagi K, Ito T, Toyoshima Y, Kakita A, Manabe T, Wakana S, Takebayashi H, Igarashi H J. Neurochem., 154(1):25-40 (2020). 31587290 |
Health Report | |
|---|---|
| Examination Date / Room / Rack | |
Gene | |||||||
|---|---|---|---|---|---|---|---|
| Gene Symbol | Gene Name | Chr. | Allele Symbol | Allele Name | Common Names | Promoter | Diseases Related to This Gene |
| Eif2b5 MGI:2446176 | eukaryotic translation initiation factor 2B, subunit 5 epsilon | 16 | Eif2b5<toy> | eukaryotic translation initiation factor 2B, subunit 5 epsilon; toy | |||
Phenotype | |
|---|---|
| Phenotype annotation from literatures by Mammalian phenotype ontology | |
| Detailed phenotype data | |
Ordering Information | |
|---|---|
| Donor DNA | |
| Research application | |
| Specific Term and Conditions | In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. J. Neurochem., 154(1):25-40 (2020). |
| Depositor | Mika Terumitsu-Tsujita (Niigata University) |
| Strain Status | Frozen sperm |
| Strain Availability | Recovered litters from cryopreserved sperm (2 to 4 months) Cryopreserved sperm (within 1 month) |
| Additional Info. | Necessary documents for ordering:
Mouse of the Month Oct 2021 |
BRC mice in Publications |
|---|
| No Data |