Strain Data Sheet

RBRC10058

Information1

Image
BRC No.RBRC10058
TypeSpontaneous Mutation Congenic
SpeciesMus musculus
Strain nameC3H.Cg-Eif2b5<toy>
Former Common nameC3HToy, Eif2b5<I98M>
H-2 Haplotype
ES Cell line
Background strainC3H/HeNCrl
Appearance
Strain developmentDeveloped by Mika Tsujita, Brain Research Institute, Niigata University in 2008. Point mutation was identified in 2012. C3H/HeN genetic background.
Strain descriptionSpontaneous mutants exhibiting phenotypes similar to the Vanishing white matter disease. A point mutation (I98M) in the Eif2b5 (eukaryotic translation initiation factor 2B, subunit 5 epsilon) gene. Homozygous mutants show decreased body weight (starting around 3 weeks old) and impaired motor coordination. Homozygous mice are infertile, but sperms can be used for in vitro fertilization. WT: GCTGCTCAGATCAAAGAACACTTAToy: GCTGCTCAGATGAAAGAACACTTA
Colony maintenance
ReferencesJ. Neurochem., 154(1):25-40 (2020). 31587290

Health Report

Examination Date / Room / Racknull

Gene

Gene info
Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter
Eif2b5eukaryotic translation initiation factor 2B, subunit 5 epsilon16Eif2b5<toy>eukaryotic translation initiation factor 2B, subunit 5 epsilon; toyEif2b5^I98M

Information2

Donor DNA
Research application
Specific Term and ConditionsIn publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. J. Neurochem., 154(1):25-40 (2020).
DepositorMika Terumitsu-Tsujita (Niigata University)
Strain Statusan icon for Frozen spermFrozen sperm
Strain AvailabilityRecovered litters from cryopreserved sperm (2 to 4 months)
Cryopreserved sperm (within 1 month)
Additional Info.Necessary documents for ordering:
  1. Order form (Japanese / English)
  2. Category I MTA: MTA for distribution with RIKEN BRC (Japanese / English)

BRC mice in Publications

No Data