Strain Data Sheet
RBRC09937
Information1 | |
|---|---|
| Image | |
| BRC No. | RBRC09937 |
| Type | Transgene |
| Species | Mus musculus |
| Strain name | B6D2-Ddx3y<em1Osb> Tg(CAG/Su9-DsRed2,Acr3-EGFP)RBGS002Osb |
| Former Common name | Ddx3y<x/+225> |
| H-2 Haplotype | |
| ES Cell line | |
| Background strain | |
| Appearance | |
| Strain development | Developed by Ayako Isotani and Masahito Ikawa, Research Institute for Microbial Diseases, Osaka University in 2013. BDF1 background. |
| Strain description | Dbx3y mutant mice (225 bp insertion) generated by the CRISPR/Cas9 technique. This strain also has a transgene, Tg(CAG/Su9-DsRed2,Acr3-EGFP)RBGS002Osb (RBRC03743).Ddx3y<em1Osb>: 225 bp insertion catgccctcatctcaatatcccataaggtacaacactaaaccagaatattaacaaagtacaagtcacgttttacttactgaaattttaaattgctaattattaaaagctgttgaaattttgtttgggtatccagtgtctatcactgtactgggatcagttattttagaagtctgtggcaatgaagagactttttgggttttgttctttttttccttgaaagGGGTCTGTGATAAGGACAGTTCAGGATGGAGCTGTAGTAAAGATAAAGATGCCTACAGCAGTTTTGGATCTCGTGATTCCAGAGGGAAGCCCAATTATTTCAGTGATCGTGG(ATCCACATTGGACGGTTGGAGATTGACTTTTGCTTTTGATTGTGGCTGTGCCCTGATATTTTCCCTCTCGAAGGAAGAAACTGTTTTAGTGGAGCCCACAGTTAAGAGACTTTTAATTGTAAAAAGACTTTGGATTTTAAAAGAGATGGCTATTTTAAAGAAATTGAAATTTTAAGAATATGTAAAGACTGTGGGACTTTTAAAGTTATTTAAATCTAATCCACA)AAGTGGATCCAGGGGAAGgtatattcttggttgataatgtacaaagtaatggttaagtatcttagtagttaagaatatgtaagaatcttaacttagcaaagtcagggttctcaaaactgatagaatgaatctgtctacctacttacctaagaatttactaattagagtggtgtacatgttgttgtccaactagtccaacaatggctatcc |
| Colony maintenance | |
| References | J. Reprod. Dev., 65(2):121-128 (2019). 30613052 |
Health Report | |
|---|---|
| Examination Date / Room / Rack | |
Gene | |
|---|---|
| Gene info | Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter DsRed2Red Fluorescent Protein (Discosoma sp.)UNDsRed2CAG promoter (CMV-IE enhancer, chicken beta-actin promoter, rabbit beta-globin genomic DNA) Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter EGFPEnhanced Green Fluorescent Protein (Aequorea victoria)UNEGFPmouse proacrosin promoter Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Su9mitochondria localization signal of mouse Atp5g1[ATP synthase Fo complex subunit 9 (su9)]UNSu9 Gene symbolGene nameChr.Allele symbolAllele nameCommon namesPromoter Ddx3yDEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linkedYDdx3y<em1Osb>endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University8030469F12Rik, D1Pas1-rs1, Dby |
Information2 | |
|---|---|
| Donor DNA | chicken beta-actin promoter, rabbit beta-globin polyadenylation signal, CMV CMV IE enhancer, mouse proacrosin signal peptide, mouse acrosin N-ternimal peptide, jellyfish GFP cDNA, mouse acrosin promoter, mouse Cdc20b genomic DNA, SV40 polyadenylation site, mouse PGK promoter, E.coli. Neomysin phosphotransferase gene (neoR), Yeast FRT site, Phage P1 loxP site |
| Research application | Cre/loxP system FLP/frt system Fluorescent Proteins/lacZ System |
| Specific Term and Conditions | The RECIPIENT of BIOLOGICAL RESOURCE shall obtain a prior written consent on use of it from the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. J Reprod Dev. 2019 Apr 12;65(2):121-128RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University. The RECIPIENT which wants to use the BIOLOGICAL RESOURCE even after five years must obtain a written consent from the DEPOSITOR again. |
| Depositor | Masahito Ikawa (Osaka University) |
| Strain Status |  Frozen sperm |
| Strain Availability |  Recovery and QC required prior to distribution |
| Additional Info. | Necessary documents for ordering:
|
BRC mice in Publications |
|---|
| No Data |