Strain Data Sheet

RBRC06449

Strain Information

Image
BRC No.RBRC06449
TypeCRISPR/Cas9 (Transgene)Cartagena
SpeciesMus musculus
Strain nameC57BL/6-H3t<em1Osb>
Former Common nameH3mmT KO, B6-H3mmT EN, H3mmT knockout mouse
H-2 Haplotype
ES Cell line
Background strain
Appearance
Strain developmentDeveloped by Jun Ueda and Kazuo Yamagata, Research Institute for Microbial Diseases, Osaka University and Kazumitsu Maehara, Akihito Harada and Yasuyuki Ohkawa, Graduate School of Medical Sciences, Kyushu University in 2013. Generated by injecting Cas9 and gRNA (GCAAGGGAGGCGGACGATTCAGG) expression plasmids into the C57BL/6 fertilized eggs. Off-target analysis was not examined.
Strain descriptionSperm specific histone H3 variant, H3mmT gene knockout mice. A 16 bp including ATG was deleted. Homozygous mutant males are infertile.
Colony maintenanceHeterozygote x Wild-type [C57BL/6NCrSlc]
References
Testis-Specific Histone Variant H3t Gene Is Essential for Entry into Spermatogenesis.
Ueda J, Harada A, Urahama T, Machida S, Maehara K, Hada M, Makino Y, Nogami J, Horikoshi N, Osakabe A, Taguchi H, Tanaka H, Tachiwana H, Yao T, Yamada M, Iwamoto T, Isotani A, Ikawa M, Tachibana T, Okada Y, Kimura H, Ohkawa Y, Kurumizaka H, Yamagata K
Cell Rep., 18(3):593-600 (2017). 28099840

Health Report

Examination Date / Room / Rack

Gene

Gene SymbolGene NameChr.Allele SymbolAllele NameCommon NamesPromoterDiseases Related to This Gene
Trim17tripartite motif-containing 1711Trim17endonuclease-mediated mutation 1, Research Institute for Microbial Diseases, Osaka University

Phenotype

Annotation by Mammalian phenotyhpe ontology
  • abnormal spermatid morphology(MP:0006380)

  • abnormal spermatogenesis(MP:0001156)

  • absent acrosome(MP:0008839)

  • absent germ cells(MP:0004806)

  • azoospermia(MP:0005159)
    • more 4 phenotypes
  • increased male germ cell apoptosis(MP:0014052)

  • male infertility(MP:0001925)

  • seminiferous tubule degeneration(MP:0001154)

  • small testis(MP:0001147)
    • Detailed phenotype data

    Ordering Information

    Donor DNA[hCas9 (addgene ID41815; CMV IE promoter, SV40 nls, human codon optimized Cas9*, neo*, TK pA), gRNA Cloning vector (addgene ID41824; human U6 polymerase III promoter, neo)] * Not detected by PCR using Marker Gene Detection kit (TOYOBO, Osaka, Japan). Other introduced genes were not tested.
    Research application
    Specific Term and ConditionsPrior to requesting the BIOLOGICAL RESOURCE, the RECIPIENT must obtain approval from the DEPOSITOR using the Approval Form. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Cell Rep. 2017 Jan 17;18(3):593-600. doi: 10.1016/j.celrep.2016.12.065. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. RECIPIENT which wants to use the BIOLOGICAL RESOURCE for the purpose other than education or not-for-profit research is requested to enter into a Material Transfer Agreement with Osaka University.
    DepositorKazuo Yamagata (Osaka University)
    Strain Statusan icon for Frozen spermFrozen sperm
    Strain AvailabilityRecovered litters from cryopreserved sperm (2 to 4 months)
    Cryopreserved sperm (within 1 month)
    Additional Info.Necessary documents for ordering:
    1. Approval form (Japanese / English)
    2. Order form (Japanese / English)
    3. Category I MTA: CRISPR/Cas9 genome edited bioresources (Japanese / English)
    4. Acceptance of responsibility for living modified organism (Japanese / English)

    Genotyping protocol -PCR-

    BRC mice in Publications

    No Data